View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_72 (Length: 242)
Name: NF20076_low_72
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 26375353 - 26375575
Alignment:
| Q |
5 |
gagagaagaaagtggtttaagaaaatggttagtttttatttctttacctctattaaggaatctttgttcaggttttgagcaacagcttgatttactagta |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375353 |
gagaaaagaaagtggtttaagaaaatggttagtttttatttctttacctctattaaggattctttgttcaggttttgagcaacagcttgatttactagta |
26375452 |
T |
 |
| Q |
105 |
aatagtttatttttgtttgctacttagaatgtctggtatattaacctttatgagaaattggttttccacgtgaaacgattgaatcactcttttatttagt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26375453 |
aatagtttatttttgtttgctacttagaatgtctggtatattaacctttatgagaaattggttttccacgtgaaacgattgaatcacacttttatttagt |
26375552 |
T |
 |
| Q |
205 |
aattagttattcaattaaattct |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26375553 |
aattagttattcaattaaattct |
26375575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University