View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_75 (Length: 238)
Name: NF20076_low_75
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 33 - 219
Target Start/End: Complemental strand, 5488658 - 5488466
Alignment:
| Q |
33 |
tttgtatgtattaaaaaagctttggagaatgttgattatgcttttcttgtgaatttggaataacactaactttaacatgaaattaatcaaattctcttcc |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5488658 |
tttgtaagtattaaaaaagctttggagaatgttgattatgcttttcttgtgaatttggaa---cactaactttaacatgaaattaatcaaattctcttcc |
5488562 |
T |
 |
| Q |
133 |
aacatgagctcctttggtatcaaaaat-aag--------ggaacattgttggttataatgggtggcatcttcttcaaattgcttttacctcccaag |
219 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5488561 |
aacatgagctcctttggtattaaaaatcaagggaaaattggaacattgttggttataatgggtggcatcttcttcaaattgcttttacctcccaag |
5488466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University