View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_78 (Length: 228)
Name: NF20076_low_78
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_78 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 67 - 209
Target Start/End: Original strand, 33817065 - 33817207
Alignment:
| Q |
67 |
accgttcctataaaatagaagggaaatctacacgagaaagaaagacaaacgaggaataaactgtgccannnnnnnatatgtatactatagatggatccaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
33817065 |
accgttcctataaaatagaagggaaatctacatgtgaaaggaagacaaacgaggaataaattgtgccatttttttatatgtatactatagatggatccaa |
33817164 |
T |
 |
| Q |
167 |
gttttaatacactaaatgagaacccacttttattggtaatggc |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33817165 |
gttttaatacactgaatgagaacccacttttattggtaatggc |
33817207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University