View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_80 (Length: 227)
Name: NF20076_low_80
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_80 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 7976083 - 7976307
Alignment:
| Q |
7 |
agttgaactacgagaaat----gagtaagggaactttatttagcaacgttttaaccatgacaacattttgagccctatgtggtaacccagttgtacaggc |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7976083 |
agttgaactacgagaaattaatgagtaagggaactgtatttagcaacgttttaaccatgacaaaattttgagccctatgtggtaacccagttgtacaggc |
7976182 |
T |
 |
| Q |
103 |
tatgggtcgggcgggtctgcatgtggtactttgcaaagattcaagtattaaggtgaaaagtcattttttgtggtaaaactcctattaactatatgtatgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7976183 |
tatgggtcgggcgggtctgcatgtggtactttgcaaagattcaagtattaaggtgaaaagtcattttttgtggtaaaactccaattaactatatgtatgt |
7976282 |
T |
 |
| Q |
203 |
gtatataaagtctttaacttctata |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7976283 |
gtatataaagtctttaacttctata |
7976307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University