View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_82 (Length: 222)
Name: NF20076_low_82
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 38829220 - 38829024
Alignment:
| Q |
13 |
cacagacaaaagagtcttgatataatggggccctcttgctccgatcgatcgataaaagatgatggcacccttcaattgaactacaaacatggttctttcg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38829220 |
cacaaacaaaagagtcttgatataatggggccctcttgctccgatcgatcgataaaagatgatggcgcccttcaattgaactacaaacatggttctttcg |
38829121 |
T |
 |
| Q |
113 |
ataagaaaacactgatgagtcggtatctttcttttggagcacaaggcctgaacatggaagattcaaatagctgtgaatcaaatgggagttataagtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829120 |
ataagaaaacactgatgagtcggtatctttcttttggagcacaaggcctgaacatggaagattcaaatagctgtgaatcaaatgggagttataagtg |
38829024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University