View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_85 (Length: 218)
Name: NF20076_low_85
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 39626298 - 39626488
Alignment:
| Q |
13 |
attatactatttaacatggtattcctatgcaaaatgccaatgtgtcaatcactatataattattgcgataaatgattgtgtttgcataacacatttgaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39626298 |
attatactatttaacatggtattcctatgcaaaatgccaatgtgtcaatcactataaaattattgcgataaatgattgtgcttgcataacacatttgaat |
39626397 |
T |
|
| Q |
113 |
ttcggatgatcaatttcttgcaggtaaaaggtttattaagttggcaaaatctccaatgtcacccccgttggctttcccttttcacattact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39626398 |
ttcggatgatcaatttcttgcaggtaaaaggtttattaagttggcaaaatctccaatgtcacccccgttggctttcccttttcacattact |
39626488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University