View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20076_low_91 (Length: 211)

Name: NF20076_low_91
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20076_low_91
NF20076_low_91
[»] chr4 (1 HSPs)
chr4 (17-192)||(26755562-26755737)


Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 26755737 - 26755562
Alignment:
17 aagggcaggaaatttggctttcttgggttaatctttctcatttcctcaacatcttgcataggtctcttgttcatagttggccattgccacttattgcttg 116  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26755737 aagggcaggaaatttggctttcttgggttgatctttctcatttcctcaacatcttgcataggtctcttgttcatagttggccattgccacttattgcttg 26755638  T
117 tgtttcgctcttcaccacctatgcagcttttagtctggaacatagtagcagcaacttgatcttcctccagtaatag 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
26755637 tgtttcgctcttcaccacctatgcagcttttagtctggaacatagtagcagcaaattgatcttcctccagtaatag 26755562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University