View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_93 (Length: 203)
Name: NF20076_low_93
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 55 - 184
Target Start/End: Complemental strand, 50549870 - 50549738
Alignment:
| Q |
55 |
gaaaagaaagatacgtgaagaccccataaagaacctcaatgaagtttctccttctatgactgacgacaaca---ataaaccaaatagtgggaaaaaggtt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50549870 |
gaaaagaaagatacgtgaagaccccataaagaacctcaatgaagtttctccttctatgactgacgacaacaataataaaccaaatagtgggaaaaaggtt |
50549771 |
T |
 |
| Q |
152 |
atgaaggaacaagtaatggttttaaagaataat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50549770 |
atgaaggaacaagtaatggttttaaagaataat |
50549738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University