View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20077_high_8 (Length: 255)
Name: NF20077_high_8
Description: NF20077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20077_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 26 - 239
Target Start/End: Original strand, 43365680 - 43365893
Alignment:
| Q |
26 |
aaccgataattgagaagttttatgtcacaagaccaatatggatactgtgatatgttctacaatctcaaaatattacaacgttgataattgattattttga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43365680 |
aaccgataattgagaagttttatgtcacaagaccaatatggatattgtgatatgttctacaatctcaaaatattacaacgttgataattgattattttga |
43365779 |
T |
 |
| Q |
126 |
atatcatatggtaccaaaataagaagatttcaaagtcaaagttgaaagaaaaataaagcatacgttgaatagtcaggtaattgatatcaatgaagaggag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43365780 |
atatcatatggtaccaaaataagaagatttcaaagtcaaagttgaaagaaaaataaagcatatgttgaatagtcaggtaattgatatcaatgaagaggag |
43365879 |
T |
 |
| Q |
226 |
acagaagcacataa |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43365880 |
acagaagcacataa |
43365893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University