View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20077_low_12 (Length: 221)
Name: NF20077_low_12
Description: NF20077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20077_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 11113516 - 11113325
Alignment:
| Q |
18 |
ctatattataaactacacataatatcatttatttaataaatttnnnnnnnnnnnnnccgtttataatcgagatcggatggatggagtaatagacaacatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11113516 |
ctatattataaactacacataatatcatttatttaataaatttaaaaagtaaaaaaccgtttataatcgagatcggatggatggagtaatagacaacatg |
11113417 |
T |
|
| Q |
118 |
aaaaaatggacaggaaagatcccaaaaattgctgctataggcttgcgaccctgaaaaataaaaacaacaaagcatggttcatgtccctatgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11113416 |
aaaaaatggacaggaaagatcccaaaaattgctgctataggcttgcgaccctgaaaaataaaaacaacaaagcatggttcatgtccctatgc |
11113325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University