View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20077_low_13 (Length: 201)
Name: NF20077_low_13
Description: NF20077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20077_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 14 - 188
Target Start/End: Original strand, 8036971 - 8037137
Alignment:
| Q |
14 |
cagtatatgccgccgccatggtcgatgctcacttccactttgttgcccggatcaaacttgaatttttgaaccatggtcactcccaatcccaaggtgtgta |
113 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036971 |
cagtatatgccgccaccacggtcgatgttcacttccactttgtttcccggatcaaacttaaatttttgaaccatggtcactcccaatcccaaggtgtgta |
8037070 |
T |
|
| Q |
114 |
tttcactacttcgtacaacaacgctgttaatattactttatagggttagggcaaaactacatgtccaacacaggt |
188 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8037071 |
tttcactactttgtacaaca--------aatattactttatagggttagggcataactacatgtccaacacaggt |
8037137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 8042450 - 8042614
Alignment:
| Q |
14 |
cagtatatgccgccgccatggtcgatgctcacttccactttgttgcccggatcaaacttgaatttttgaaccatggtcactcccaatcccaaggtgtgta |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||| |||||| ||| |||||||| |
|
|
| T |
8042450 |
cagtatatgccgatgccatggtcgatgctcacttccactttgttgccgggatggaacttgaattttccaaccatgatcactctcaa------ggtgtgta |
8042543 |
T |
|
| Q |
114 |
tttcactacttcgtacaacaacgctgttaatattactttatagggttagggcaaaactacatgtccaacac |
184 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8042544 |
ttccactactccgtacaacaacgctgttaatattactttataggattagggcaaaactacatgtcaaacac |
8042614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 8415985 - 8415826
Alignment:
| Q |
14 |
cagtatatgccgccgccatggtcgatgctcacttccactttgttgcccggatcaaacttgaatttttgaaccatggtcactcccaatcccaaggtgtgta |
113 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||| |||| |||||||||||| |||||||| |||||| ||| |||||||| |
|
|
| T |
8415985 |
cagtatatgccgccgcctctgtcgttgctcacttccactttgttgcctggattgaacttgaattttcgaaccatgatcactctcaa------ggtgtgta |
8415892 |
T |
|
| Q |
114 |
tttcactacttcgtacaacaacgctgttaatattactttatagggttagggcaaaactacatgtccaacacag |
186 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
8415891 |
ttccactact-------acaacgctgttaatattactttattgggttagggcaaaactacatgtcaaacacag |
8415826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 95
Target Start/End: Complemental strand, 8410161 - 8410100
Alignment:
| Q |
34 |
gtcgatgctcacttccactttgttgcccggatcaaacttgaatttttgaaccatggtcactc |
95 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
8410161 |
gtcgttgctcacttccactttgttgcccggatcgaacttgaatttttcaaccatgatcactc |
8410100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 125 - 189
Target Start/End: Original strand, 9140171 - 9140235
Alignment:
| Q |
125 |
cgtacaacaacgctgttaatattactttatagggttagggcaaaactacatgtccaacacaggtt |
189 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||| | |||| |||||||||| |
|
|
| T |
9140171 |
cgtacaacaacgctgttaatcttactttatagggttagggcataactgcgtgtcaaacacaggtt |
9140235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 9140077 - 9140123
Alignment:
| Q |
18 |
atatgccgccgccatggtcgatgctcacttccactttgttgcccgga |
64 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9140077 |
atatgccgctgccgcggtcgatgctcacttccactttgttgcccgga |
9140123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University