View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20077_low_5 (Length: 328)
Name: NF20077_low_5
Description: NF20077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20077_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 12 - 318
Target Start/End: Complemental strand, 8205477 - 8205171
Alignment:
| Q |
12 |
atcatcatcggagctgcggcaatgtgttgaggcaatcggggcaaagatgtcgaacgaggaggcggaaatggcggttgagcttctcgactcggacggtgat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8205477 |
atcatcatcggagctgcggcaatgtgttgaggcaatcggggcaaagatgtcaaacgaggaggcggaaatggcggttgagcttctcgactcggacggggat |
8205378 |
T |
|
| Q |
112 |
gggttgattgggttggatgattttgtgaagtttgtagagggagggaaagaggaagagaaagtaaatgacctaagagaggcttttaagatgtatgaaatgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205377 |
gggttgattgggttggatgattttgtgaagtttgtagagggagggaaagaggaagagaaagtaaatgacctaagagaggcttttaagatgtatgaaatgg |
8205278 |
T |
|
| Q |
212 |
agggatgtggttgcatcacaccaaagagtctaaagagaatgcttggaagattgggtgagtgtagaagtatagatgagtgtcaagctatgatttctcaatt |
311 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
8205277 |
aaggatgtggttgcatcacaccaaagagtctaaagagaatgcttggaagattgggtgagtgtagaagtgtagatgaatgtcaagctatgatttctcaatt |
8205178 |
T |
|
| Q |
312 |
tgatatt |
318 |
Q |
| |
|
||||||| |
|
|
| T |
8205177 |
tgatatt |
8205171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University