View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_13 (Length: 416)
Name: NF20078_high_13
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 173 - 400
Target Start/End: Complemental strand, 14821856 - 14821629
Alignment:
| Q |
173 |
acaacataccgagacaatcttgcttgtgcaacacagcatcatgcactttttgaatgccccagccattactctctttggtcttcttcaccctgctttgcat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14821856 |
acaacataccgagacaatcttgcttgtgcaacacagcatcatgcactttttgaatgccccagccattactctctttggtcttcttcaccctgctttgcat |
14821757 |
T |
|
| Q |
273 |
ttacagaaagaaaaacaaaattaatcatctcaaacataaatagaaccaaataatttggttatggaaattgttgtgtannnnnnnggacccttgagctaca |
372 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14821756 |
ttacagaaagaaaaacaaaatcagtcatctcaaacataaatagaaccaaataatttggttatggaaattgttgtgtattttgttggacccttgagctaca |
14821657 |
T |
|
| Q |
373 |
tgtaagttggacttggaggcctacttta |
400 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
14821656 |
tgaaagttggacttggaggcctacttta |
14821629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University