View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_16 (Length: 403)
Name: NF20078_high_16
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Complemental strand, 43561668 - 43561276
Alignment:
| Q |
1 |
attgcgctcaacaatctcactcagctctgaagtctctgactcaccttcatattcatcagagtcttcagagcttagtgagattgttgagcttcctaatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561668 |
attgcgctcaacaatctcactcagctctgaagtctctgactcaccttcatattcatcagagtctacagagcttagtgagattgttgagcttcctaatata |
43561569 |
T |
 |
| Q |
101 |
gaagagagttataactcggttgagttgagaagtgagtttatgttgattgactcggttgaaagttggttgtatccgtcagtagaaagtttatgtgacatga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561568 |
gaagagagttataactcggttgaggtgagaagtgagtttatgttgattgactcggttgaaagttggttgtatccgtcagtagaaagtttatgtgacatga |
43561469 |
T |
 |
| Q |
201 |
tggttgaagaacagagttttttgttataataaaaagaacatagtttagttgtgatattcagcaatgccatatttggttt--ggttttgtgaagtttagat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43561468 |
tggttgaagaacagagttttttgttataataaaaagaacatagtttagttgtgatattcagcaatgccatatttggtttagggttttgtgaagtttagat |
43561369 |
T |
 |
| Q |
299 |
tatt----gtttgcctcactttcatcagtgtaatataagtacccttcaactgaatttcatcactctttcttcttctctttggtactaaaaaag |
387 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561368 |
tattgttggtttgcctcactttcatcagtgtaatataagtacccttcaactgaatttcatcactctttcttcttctctttggtactaaaaaag |
43561276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University