View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_21 (Length: 388)
Name: NF20078_high_21
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 27184767 - 27184645
Alignment:
| Q |
9 |
gataattcttggagcttaatttcttaccattttgcagggcatggcctaagattttgtagtgtgcacaatacaagggttactaatcatatttgatagcaac |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27184767 |
gataattctttgagcttaatttcttaccattttgcagggcatggcctaagattttgtagtgtgcacaatacaacggttactaatcatatttgatagcaac |
27184668 |
T |
|
| Q |
109 |
agggaaggcatgcccctcccttt |
131 |
Q |
| |
|
| |||||||||| |||||||||| |
|
|
| T |
27184667 |
aaggaaggcatgtccctcccttt |
27184645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 20 - 300
Target Start/End: Original strand, 38172615 - 38172897
Alignment:
| Q |
20 |
gagcttaatttcttaccattttgcagggcatggcctaagattttgtagtgtgcacaatacaagggttactaatcatatttgatagcaacagggaaggcat |
119 |
Q |
| |
|
||||||| |||||||| | |||||| || ||| ||||| ||||| ||||||||||||||| ||||| || ||||||| ||||||| ||||||||||| |
|
|
| T |
38172615 |
gagcttactttcttacaactttgcaaggtatgacctaacattttacagtgtgcacaatacatgggtttcttctcatattcaatagcaatagggaaggcat |
38172714 |
T |
|
| Q |
120 |
gcccctccctttccacaagaacataa-aaaacagtcttccagacatgtccacatccactaacaccatatcgtacaagacaaacaccttagcaagagtaac |
218 |
Q |
| |
|
||||||||||||||| |||||| || ||||| |||||||||||| |||||||||||||||||| || | |||||| ||||||| ||| | ||| | |
|
|
| T |
38172715 |
acccctccctttccactagaacagaatcaaacaatcttccagacatatccacatccactaacaccctaacttacaagtcaaacactctagacaaagtcgc |
38172814 |
T |
|
| Q |
219 |
ctcatctatagtta-ggggtacatatacctaaagctatctcaaacaacgtcttatgtctccaatactcttgagagaggtgcat |
300 |
Q |
| |
|
||| ||||| || | ||||||| |||||| |||||||||| ||||||||||| | |||||||||||||||| ||| ||||| |
|
|
| T |
38172815 |
ctcgtctatggtaagggggtaccaatacctgaagctatctcgaacaacgtcttcttcctccaatactcttgagggagatgcat |
38172897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University