View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_32 (Length: 294)
Name: NF20078_high_32
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 286
Target Start/End: Complemental strand, 48437392 - 48437125
Alignment:
| Q |
19 |
ctgagaccattcgatgtgctcttgaccttggtgttaatgttaagatgatcactggtgatcaacttgccattggaaaagaaaccggtcgcagacttggaat |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48437392 |
ctgagaccattcgacgtgctcttgaccttggtgttaatgttaagatgatcactggtgatcaacttgccattggaaaagaaaccggtcgcagacttggaat |
48437293 |
T |
 |
| Q |
119 |
gggcaccaacatgtacccttcatcatctcttctcggtgataacacagaccctgccattgcatccatcccaattgatgaactcattgagaaggctgatgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48437292 |
gggcaccaacatgtacccttcatcatctcttctcggtgataacacagaccctgccattgcatccatcccaattgatgaactcattgagaaggctgatgga |
48437193 |
T |
 |
| Q |
219 |
tttgccggagtcttccctggtaactaattatcgacatcaatataatataatcttttgaacttcatctc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
48437192 |
tttgccggagtcttccctggtaactaattatcgacatcaatataatataatctttggaacttcgtctc |
48437125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 21981105 - 21980883
Alignment:
| Q |
19 |
ctgagaccattcgatgtgctcttgaccttggtgttaatgttaagatgatcactggtgatcaacttgccattggaaaagaaaccggtcgcagacttggaat |
118 |
Q |
| |
|
||||||| ||||| | ||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21981105 |
ctgagactattcgtcgcgctcttgacctcggtgtcaatgttaagatgatcactggcgatcaacttgccattggaaaagaaactggtcgcagacttggaat |
21981006 |
T |
 |
| Q |
119 |
gggcaccaacatgtacccttcatcatctcttctcggtgataacacagaccctgccattgcatccatcccaattgatgaactcattgagaaggctgatgga |
218 |
Q |
| |
|
||| |||||||||||||||||||| || ||||| || | || || | ||||||||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
21981005 |
gggaaccaacatgtacccttcatcctcccttcttggccaatccaatgatgcagccattgcatcaattccaattgatgaacttattgagaaggctgatgga |
21980906 |
T |
 |
| Q |
219 |
tttgccggagtcttccctggtaa |
241 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
21980905 |
tttgctggagtcttccctggtaa |
21980883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 45197787 - 45197738
Alignment:
| Q |
192 |
gatgaactcattgagaaggctgatggatttgccggagtcttccctggtaa |
241 |
Q |
| |
|
||||| || ||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
45197787 |
gatgagcttattgagaaggctgatggatttgctggtgtcttccctggtaa |
45197738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University