View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_39 (Length: 253)
Name: NF20078_high_39
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 5684007 - 5684232
Alignment:
| Q |
15 |
atagatgatgcaattgaagatggtgttgatgttataaacctttccattgggtttcctgcgccattgaaatatgaggatgatgtgattgctaagggtgcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684007 |
atagatgatgcaattgaagatggtgttgatgttataaacctttccattgggtttcctgcgccattgaaatatgaggatgatgtgattgctaagggtgcat |
5684106 |
T |
 |
| Q |
115 |
tacaagctgtaaggaaaaacattgttgttgtttgtagtgctggaaatgctggcccttctcctcatagtttgtcaaatcctgccccttggatcatcacggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5684107 |
tacaagctgtaaggaaaaacattgttgttgtttgtagtgctggaaatgctggcccttctcctcatagtttgtcaaatccttccccttggatcatcacggt |
5684206 |
T |
 |
| Q |
215 |
tggtgctagtactgtcgatcgaacct |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5684207 |
tggtgctagtactgtcgatcgaacct |
5684232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 5693883 - 5694108
Alignment:
| Q |
15 |
atagatgatgcaattgaagatggtgttgatgttataaacctttccattgggtttcctgcgccattgaaatatgaggatgatgtgattgctaagggtgcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| | ||||||| ||| | || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5693883 |
atagatgatgcaattgaagatggtgttgatgttttaagcatttccatagggcattatggtccattgaaatatgaagatgatgtgattgctaagggtgcat |
5693982 |
T |
 |
| Q |
115 |
tacaagctgtaaggaaaaacattgttgttgtttgtagtgctggaaatgctggcccttctcctcatagtttgtcaaatcctgccccttggatcatcacggt |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| ||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5693983 |
tacaagctgtaaggaaaaacattgtggttgtttgtagtgctggaaattttggtccttttccacatagtttgtcaaatcctgccccttggatcatcactgt |
5694082 |
T |
 |
| Q |
215 |
tggtgctagtactgtcgatcgaacct |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5694083 |
tggtgctagtactgtcgatcgaacct |
5694108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University