View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_45 (Length: 237)
Name: NF20078_high_45
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 27184547 - 27184371
Alignment:
| Q |
45 |
ctgattcatactcttcccatgagatttttacacaaactacatcaccgatgtaaaccttaggggggaagttgattcaactcgatatcataaaatgctgaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27184547 |
ctgattcatactcttcccatgagattttcacacaaactgcataaccgatgtaaaccttaggggggaagttgattcaactcgatatcacaaaatgctgaaa |
27184448 |
T |
 |
| Q |
145 |
gtgcttgagcgaaagatttgttgttgttgctcttctctggcaccaccgtctctgacggagcaaggaagggccaaagg |
221 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27184447 |
gagcttgaacgaaagatttgttgttgttgctcttctttggcaccaccgtctccgacggagcaaggaagggccaaagg |
27184371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University