View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_high_48 (Length: 217)
Name: NF20078_high_48
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 5684007 - 5684192
Alignment:
| Q |
15 |
atagatgatgcaattgaagatggtgttgatgttataaacctttccattgggtttcctgcgccattgaaatatgaggatgatgtgattgctaagggtgcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684007 |
atagatgatgcaattgaagatggtgttgatgttataaacctttccattgggtttcctgcgccattgaaatatgaggatgatgtgattgctaagggtgcat |
5684106 |
T |
 |
| Q |
115 |
tacaagctgtaaggaaaaacattgttgttgtttgtagtgctggaaatgctggcccttctcctcatagtttgtcaaatcctgcccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5684107 |
tacaagctgtaaggaaaaacattgttgttgtttgtagtgctggaaatgctggcccttctcctcatagtttgtcaaatccttcccct |
5684192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 5693883 - 5694068
Alignment:
| Q |
15 |
atagatgatgcaattgaagatggtgttgatgttataaacctttccattgggtttcctgcgccattgaaatatgaggatgatgtgattgctaagggtgcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| | ||||||| ||| | || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5693883 |
atagatgatgcaattgaagatggtgttgatgttttaagcatttccatagggcattatggtccattgaaatatgaagatgatgtgattgctaagggtgcat |
5693982 |
T |
 |
| Q |
115 |
tacaagctgtaaggaaaaacattgttgttgtttgtagtgctggaaatgctggcccttctcctcatagtttgtcaaatcctgcccct |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
5693983 |
tacaagctgtaaggaaaaacattgtggttgtttgtagtgctggaaattttggtccttttccacatagtttgtcaaatcctgcccct |
5694068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University