View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_22 (Length: 369)
Name: NF20078_low_22
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 300
Target Start/End: Complemental strand, 45000025 - 44999751
Alignment:
| Q |
14 |
gaatgaagagttttgcagctaaagtagaagaaggaagagaaggcaaaaatggcaagctatctgtaggtccagtatatcgcaaccttctagctaaagatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45000025 |
gaatgaagagttttgcagctaaagtagaagaaggaagagaaggcaaaaatggcaagctatctgtaggtccagtatatcgcaaccttctagctaaagatca |
44999926 |
T |
|
| Q |
114 |
atttccaccatctgatcctgatttaactacagcttgggatattttcaggtatatgatatttttcatgcnnnnnnngttggttttaaattgagttacgacg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
44999925 |
atttccaccatctgatcctgatttaactacagcttgggatattttcaggtatatg-ta-----------aaaaaagttggttttaaattgagttacgacg |
44999838 |
T |
|
| Q |
214 |
ttgttgaccacaatttaaaactatgcttagaatatactataaattgatcaaagagtaatgataattaactttcctaatgagcttcct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999837 |
ttgttgaccacaatttaaaactatgcttagaatatactataaattgatcaaagagtaatgataattaactttcctaatgagcttcct |
44999751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University