View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_26 (Length: 332)
Name: NF20078_low_26
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 13 - 315
Target Start/End: Complemental strand, 4420928 - 4420628
Alignment:
| Q |
13 |
aaaatctatgtaagtttgctataactcaggtgtatctagaatcagaaaaatgataaaatctagaacgatgttgaaattcctccatgtttaacggtgcatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
4420928 |
aaaatctatgtaagtttgctataactcgggtgtatctagaatcagaaaaatgataaattctagaacgatgttgaaattcctccatgtctgacggtgcatt |
4420829 |
T |
 |
| Q |
113 |
tggtgcatgatacttgtatcgagtggaagaatgtgtgtattcgaagagaacaacatgaagcattgtaagatgcctcatcttcaagctctaatcagataga |
212 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4420828 |
tggtgcatgatacttgtctcgaatggaagaatgtgt--attcgaagagaacaacatgaagcattgtaagatgcctcatcttcaagctctaatcaaataga |
4420731 |
T |
 |
| Q |
213 |
tgttgataagattcgttggcaatgacttgaagcaggagcgttgaagtgcaatgtggcttggaaatctttaaggagcaaggatggtatggtatagggatgt |
312 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4420730 |
tgttgataagatttgttggcaatgacctgaagcaggagcgttgaagtgcaatgtggcttggaaatctttaaggagcaaggatggtatggtatagggatgt |
4420631 |
T |
 |
| Q |
313 |
atc |
315 |
Q |
| |
|
||| |
|
|
| T |
4420630 |
atc |
4420628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University