View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_30 (Length: 305)
Name: NF20078_low_30
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 43068924 - 43068647
Alignment:
| Q |
18 |
ttcataagttctgatagttcatataagggaccatttgaatgtgatgatgatgaagatgacaaactagaagttgaagaggatacttcttgatcatcatcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43068924 |
ttcataagttctgatagttcatataagggaccatttgaatgtgatgatgatgaagatgacaaactagaagttgaagaggatgcttcttgatcatcatcta |
43068825 |
T |
 |
| Q |
118 |
actctgatgaagaagatgaacacatagaattcattgaatcttctgtaatagatccattcgaaattgaatcagttacatcatcatcatccacatcttgctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43068824 |
actctgatgaagaagatgaacacatagaattcattgaatcttctgtaatagatccattcgaaattgaatcagttacatcatcatcatccacatcttgctt |
43068725 |
T |
 |
| Q |
218 |
aacaatccaatttttgttactgttaccatctttgattcccttcacattcatttctagaaatatttgttttgccctttg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43068724 |
aacaatccaatttttgttactgttaccatctttgattcccttcacattcatttctagaaatatttgttttgccctttg |
43068647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University