View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_31 (Length: 297)
Name: NF20078_low_31
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_31 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 297
Target Start/End: Complemental strand, 29009022 - 29008744
Alignment:
| Q |
19 |
gttacggtgttatattcattcaattagatgaagaatttgaatcgaagctatagttaactctgtgnnnnnnnnnnnnnnnnnnnnnnnntaggaaaatgag |
118 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29009022 |
gttacggtgttgtattcattcgattagatgaagaatttgaatcgaagctatagttaactctgtgtttttgattttttggtttgatttgtaggaaaatgag |
29008923 |
T |
 |
| Q |
119 |
gccagtctgggcagtgaaagctatgttcgtggtcgtcttggcttcaattctcttccgttgcgtttgtggtggtaaccacaccgttggtggtgcttccgcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008922 |
gccagtctgggcagtgaaagctatgttcgtggtcgtcttggcttcgattctcttccgttgcgtttgtggtggtaaccacaccgttggtggtgcttccgcc |
29008823 |
T |
 |
| Q |
219 |
tgggatcttgaatccaatatgcaggtttgggcttccactgagagcttcaacgtcggcgacgatctcggtacgtttcttc |
297 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008822 |
tgggatcttgaatccaatatgcaggattgggcttccactgagagcttcaacgtcggcgacgatctcggtacgtttcttc |
29008744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University