View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_41 (Length: 247)
Name: NF20078_low_41
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 3 - 231
Target Start/End: Original strand, 382191 - 382419
Alignment:
| Q |
3 |
atattatagtacattacctatttcataagcaatacatccaataaaaatgatcaaattacattgcccttaaaaagatcttagttacttcataagattagtc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
382191 |
atattatagtacattacctatttcataagcaatacatccaataaaaatgatcaaattacattgcccttaaaaagatcttagttacttcataagattagtc |
382290 |
T |
 |
| Q |
103 |
tctaccctagttttccatgaaaaacaaaattacattgtcatatgtgctctcaacctttaaattaccattcccgacgacacattgggcaatgtgcttgtga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
382291 |
tctaccctagttttccatgaaaaacaaaattacattgtcatatgtgctctcaacctttaaattgccattcccgacgacacattgggcaatgtgcttgtga |
382390 |
T |
 |
| Q |
203 |
ggtttgagaattcacccatttcaagatac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
382391 |
ggtttgagaattcacccatttcaagatac |
382419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 144 - 231
Target Start/End: Original strand, 1022594 - 1022681
Alignment:
| Q |
144 |
atgtgctctcaacctttaaattaccattcccgacgacacattgggcaatgtgcttgtgaggtttgagaattcacccatttcaagatac |
231 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1022594 |
atgttctctcaacctttaaattgccattcccgacggcacattgggcaatgtgcttgtgaggtctgagaattcacccatttcaagatac |
1022681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 64
Target Start/End: Original strand, 1022477 - 1022538
Alignment:
| Q |
3 |
atattatagtacattacctatttcataagcaatacatccaataaaaatgatcaaattacatt |
64 |
Q |
| |
|
||||||||||| |||| || | || ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
1022477 |
atattatagtatattagctgatacaaaagcaatgcatccaatacaaatgatcaaattacatt |
1022538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University