View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20078_low_42 (Length: 242)

Name: NF20078_low_42
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20078_low_42
NF20078_low_42
[»] chr1 (1 HSPs)
chr1 (18-224)||(7569235-7569442)
[»] chr3 (1 HSPs)
chr3 (169-203)||(33561032-33561066)
[»] chr2 (1 HSPs)
chr2 (172-208)||(6300353-6300389)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 7569442 - 7569235
Alignment:
18 acatgtgactcatgtcatacttgattggtattaagccaccgtcttgattgatatctttgcgggctactttaaaaattaatccataa----gttaggatca 113  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    | ||||||||    
7569442 acatgtgactcatgtcacacttgattggtattaagccaccgtcttgattgatatctttgcgggctattttaaaaattaatccataagcttgataggatca 7569343  T
114 taataaacgataaaactttttattaaaagataatattgttccatttcaaattaattgaattcgaattcaaaacatttggttaagttaaaagagatattcc 213  Q
    |||||||| |||||||| ||  ||||||||||||||||||||||| |||   |||||||||||| |||| |||||||| |||||||||||||||||  ||    
7569342 taataaactataaaactcttcgttaaaagataatattgttccattccaa---aattgaattcgacttcagaacatttgattaagttaaaagagatacacc 7569246  T
214 accgtctcatt 224  Q
    ||| |||||||    
7569245 accatctcatt 7569235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 203
Target Start/End: Complemental strand, 33561066 - 33561032
Alignment:
169 tgaattcgaattcaaaacatttggttaagttaaaa 203  Q
    ||||||||||||||||||||||||||||| |||||    
33561066 tgaattcgaattcaaaacatttggttaagataaaa 33561032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 208
Target Start/End: Complemental strand, 6300389 - 6300353
Alignment:
172 attcgaattcaaaacatttggttaagttaaaagagat 208  Q
    ||||||| |||||||||||||||||| ||||||||||    
6300389 attcgaactcaaaacatttggttaagctaaaagagat 6300353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University