View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20078_low_45 (Length: 237)

Name: NF20078_low_45
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20078_low_45
NF20078_low_45
[»] chr3 (1 HSPs)
chr3 (45-221)||(27184371-27184547)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 27184547 - 27184371
Alignment:
45 ctgattcatactcttcccatgagatttttacacaaactacatcaccgatgtaaaccttaggggggaagttgattcaactcgatatcataaaatgctgaaa 144  Q
    |||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
27184547 ctgattcatactcttcccatgagattttcacacaaactgcataaccgatgtaaaccttaggggggaagttgattcaactcgatatcacaaaatgctgaaa 27184448  T
145 gtgcttgagcgaaagatttgttgttgttgctcttctctggcaccaccgtctctgacggagcaaggaagggccaaagg 221  Q
    | |||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
27184447 gagcttgaacgaaagatttgttgttgttgctcttctttggcaccaccgtctccgacggagcaaggaagggccaaagg 27184371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University