View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_47 (Length: 219)
Name: NF20078_low_47
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 74 - 203
Target Start/End: Original strand, 41041502 - 41041631
Alignment:
| Q |
74 |
tctaataatggattttgtaccggccaacaaagtatctgtattgttgggctacattaggagtctttcggttagataagtcctttgttcttgagaatattgc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41041502 |
tctaataatggattttgtaccggccaacgaagtatctgtattgttgggctacattaggagtctttcggttagataagtcctttgttcttgagaatattgc |
41041601 |
T |
 |
| Q |
174 |
ttctatatgatctccttggatcctaatatt |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
41041602 |
ttctacatgatctccttggatcctaatatt |
41041631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 41041452 - 41041486
Alignment:
| Q |
18 |
gaattaactaatcaatctaacaggcttgttaactc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41041452 |
gaattaactaatcaatctaacaggcttgttaactc |
41041486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University