View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20078_low_49 (Length: 216)
Name: NF20078_low_49
Description: NF20078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20078_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 30637687 - 30637508
Alignment:
| Q |
17 |
aatactcagctgaagaatcaaaaactaattaagcatataatatagatgtgtatatatcactttgtgcttatggaac----ttaggatatggttcaaattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30637687 |
aatactcagctgaagaatcaaaaactaattaagcatataatatagatgtatatatatcactttgtgcttatggaacttaattaggatatggttcaaattt |
30637588 |
T |
|
| Q |
113 |
gaatttttatcattaacatggg-tttgcttcgaccaccgagctacgaagatgttacgcaaaaagtatcaacttattagta |
191 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30637587 |
gaatttttatctttaatatgggttttgcttcgaccaccgagctacgaagatgttacgcaaaaagtatcaacttaatagta |
30637508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University