View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_high_15 (Length: 306)
Name: NF20079_high_15
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 16 - 142
Target Start/End: Original strand, 30624870 - 30624996
Alignment:
| Q |
16 |
attccaatagcagattgttccaatatattattatcacctggttcgtcctaatcatcaatctgctcccccggtacagacgggagtctccctctttttgtac |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30624870 |
attccaatagcagattgttcaaatatattattatcaccaggttcgtcctaatcatcaatctgctcccccggtacagacgggagtctccctctttttgtac |
30624969 |
T |
|
| Q |
116 |
ttttcgtttctctcactaactaagata |
142 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
30624970 |
tttccgtttctctcactaactaagata |
30624996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 155 - 292
Target Start/End: Original strand, 30625021 - 30625159
Alignment:
| Q |
155 |
gttccatgcaaagacccacaacacaataattcatgcatgacatacaaccnnnnnnnnnn-cttttatattatggtttcaactgctagtagggatacgata |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30625021 |
gttccatgcaaagacccacaacacaataattcatgcatgacatacaacctttttttttttcttttaaattatggtttcaactgctagtagggatacgata |
30625120 |
T |
|
| Q |
254 |
ctatgatcactaggaatattttattagttgatatttttg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30625121 |
ctatgatcactaggaatattttattagttgatatttttg |
30625159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University