View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_high_21 (Length: 271)
Name: NF20079_high_21
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_high_21 |
 | |
|
| [»] scaffold0028 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0028 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 118808 - 119061
Alignment:
| Q |
18 |
caaatgactcaagtattgaatcggtatctgatgtgtttgatggaatggtatgttctgtagtttttgcatgaccattttcaagatttgggtcgacatttgc |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
118808 |
caaatgactcatgtattgaatcggtatctgatgtgtttgatggaatggtatgttctgtagtttttgcatggccattttcatgatttgggtcaacatttgc |
118907 |
T |
|
| Q |
118 |
agatggaataggatgggctgtagctgcaaatttggtgagaaggttgatgcctctcttaggttgtcgaggcagtctacaatgaatttgagcattgggttga |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
118908 |
agatggaataggatgggctgcagctgcaaatttggtgagaaggttgatgcctctcttaggttgtcgaggcagtctacaatgagtttgagcattgggttga |
119007 |
T |
|
| Q |
218 |
gtaaatgttttttcgtccaatgtatttggtacatggctctggttaggaagtaat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
119008 |
gtaaatgttttttcgtccaatgtatttggtacatggctctggttaggaagtaat |
119061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 219
Target Start/End: Original strand, 22073269 - 22073364
Alignment:
| Q |
124 |
aataggatgggctgtagctgcaaatttggtgagaaggttgatgcctctcttaggttgtcgaggcagtctacaatgaatttgagcattgggttgagt |
219 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||||||||||||| || ||||||| || ||||||| | ||| |||||||||| | ||||||||||| |
|
|
| T |
22073269 |
aataggatttgctgtagctacaaatttgctgagaaggttgatcccactcttagaatgccgaggcattttactatgaatttgatcgttgggttgagt |
22073364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University