View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20079_high_22 (Length: 250)

Name: NF20079_high_22
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20079_high_22
NF20079_high_22
[»] chr1 (1 HSPs)
chr1 (13-250)||(2553428-2553664)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 2553428 - 2553664
Alignment:
13 aaaatagcagataaaaaacgagtgcttccaggagcaccttcaagatgtttcacagaaaaggctgcatgtgaagcaccatgacaacacatgtttgaaatag 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2553428 aaaatagcagataaaaaacgagtgcttccaggagcaccttcaagatgtttcacagaaaaggctgcatgtgaagcaccatgacaacacatgtttgaaatag 2553527  T
113 tggtaggttttccaaaaacttttgcaaaatcatggtggctcaccgtaattttgccaactccaccgtgaatccaaacatggacttaaactgaactgacagc 212  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
2553528 tggtaggttt-ccaaaaacttttgcaaaatcatggtggctcaccgtaattttgccaaccccaccgtgaatccaaacatggacataaactgaactgacagc 2553626  T
213 tttatggcgatagaggctattctgaatatttgcaactc 250  Q
    ||||||||||||||||||||||||||||||||||||||    
2553627 tttatggcgatagaggctattctgaatatttgcaactc 2553664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University