View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_high_26 (Length: 210)
Name: NF20079_high_26
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 49808850 - 49809044
Alignment:
| Q |
1 |
taacaagggataaaaagagattgatatttatgttttatggaccctattggtcattagacnnnnnnnnnnnnnnn----ataataa--taatatttgtcat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
49808850 |
taacaagggataaaaagagattgatatttatgttttagggaccctattggtcattagactttttatttttatttttttataataaaatattatttgtcat |
49808949 |
T |
 |
| Q |
95 |
tcgaccacgatgagtatgagtctataaattttcatcattcaaccagaacacaaaaggatccgcttgaaaaatttgttgaactttgatacttgtgatgaac |
194 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49808950 |
tcgactacgatgagtgt------ataaattttcatcattcaactagaacacaaaaggatccgcttaaaaaatttgttgaactttgatacttgtgatgaac |
49809043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University