View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_low_22 (Length: 250)
Name: NF20079_low_22
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_low_22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 2553428 - 2553664
Alignment:
| Q |
13 |
aaaatagcagataaaaaacgagtgcttccaggagcaccttcaagatgtttcacagaaaaggctgcatgtgaagcaccatgacaacacatgtttgaaatag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2553428 |
aaaatagcagataaaaaacgagtgcttccaggagcaccttcaagatgtttcacagaaaaggctgcatgtgaagcaccatgacaacacatgtttgaaatag |
2553527 |
T |
|
| Q |
113 |
tggtaggttttccaaaaacttttgcaaaatcatggtggctcaccgtaattttgccaactccaccgtgaatccaaacatggacttaaactgaactgacagc |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2553528 |
tggtaggttt-ccaaaaacttttgcaaaatcatggtggctcaccgtaattttgccaaccccaccgtgaatccaaacatggacataaactgaactgacagc |
2553626 |
T |
|
| Q |
213 |
tttatggcgatagaggctattctgaatatttgcaactc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2553627 |
tttatggcgatagaggctattctgaatatttgcaactc |
2553664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University