View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_low_24 (Length: 244)
Name: NF20079_low_24
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_low_24 |
 | |
|
| [»] scaffold0028 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0028 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 119360 - 119117
Alignment:
| Q |
1 |
atacttttaactacacaacacctctggcagagattacaaatgctaaacaaattttctttactaaccatgatcatgttacaaacactgttgaatcatcctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
119360 |
atacttttaactacacaacacctctggcagagattacaaatgctaaacaaattttctttactaaccatgatcatgttacaaacactgttgactcatcctc |
119261 |
T |
|
| Q |
101 |
tatcaccacaactccattacaatccaaacttccacattaccataaagaaaactcaactgcttcaagagttaatagaacatcagttcgtttagataaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
119260 |
tatcaccacaactccattacaatccaaacttccacattaccataaagaaaactcaactgcttcaagagttaatagaacatcagttcttttagataaaaca |
119161 |
T |
|
| Q |
201 |
gtttcaccatcttttccaatccctaatactcccactacatccaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
119160 |
gtttcaccatcttttccaatccctaatactcccactatatccaa |
119117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University