View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_low_6 (Length: 410)
Name: NF20079_low_6
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 11 - 263
Target Start/End: Original strand, 28021294 - 28021546
Alignment:
| Q |
11 |
caaaggtagatcatcatcatgaaaatcagcatcaatcaaagaatgtccatacaccaaaatgatgccaaagtatttgatactctttcgcactcaaaattca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28021294 |
caaaggtagatcatcatcatgaaaatcagcatcaatcaaagaatgtccatacaccaaaatgatgccaaagtatttgatactctttcgcactcaaaattca |
28021393 |
T |
 |
| Q |
111 |
tgttgaagtcttgattggtgaaagaaggcttgttcttgttttgattcttggtctctagttttatttgcaaagtcttcttcaagctgttgctgctggtaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28021394 |
tgttgaagtcttgattggtgaaagaaggcttgttcttgttttgattcttggtctctagttttatttgcaaagtcttcttcaagctgttgctgctggtaga |
28021493 |
T |
 |
| Q |
211 |
agaatgttttctctccatctttaataaaatttgtgaatttcgatccaaaatac |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28021494 |
agaatgttttctctccatctttaataaaatttgtgaatttcgatccaaaatac |
28021546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 337 - 398
Target Start/End: Original strand, 28021615 - 28021676
Alignment:
| Q |
337 |
aatcattgttgatttgcccnnnnnnngtcattgttagtggtcttaatagatgcggatactga |
398 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
28021615 |
aatcattgttgatttgcccaaaaaaagtaattgttagtggtcttaatagatgcggatactga |
28021676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University