View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20079_low_7 (Length: 384)
Name: NF20079_low_7
Description: NF20079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20079_low_7 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 14 - 367
Target Start/End: Original strand, 50061 - 50414
Alignment:
| Q |
14 |
gagagtatcacattcggagagctttgctagtgtcagggctatcaccaagcatttcacggatcttcacttcagaagaccaaccaccgtgagagagaaacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
50061 |
gagagtatcacattcggagagctttgctagtgtcagggctatcaccaagcatttcacggatcttcacttcagaagaccaaccaccgtgagagagaaacct |
50160 |
T |
 |
| Q |
114 |
aaatattgcatcgccgcgccgacgtaagtggggcgttccggcaggattcttcacgcgaagcttcgccgcctgcggtgtctcgcgtttgatttcagcatca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50161 |
caatattgcatcgccgcgccgacgtaagtgtggcgttccggcaggattcttcacgcgaagcttcgccgccggcggtgtctcgcgtttgatttcagcatca |
50260 |
T |
 |
| Q |
214 |
atcacactcctacacttgcttgctctgtgagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgtcgcttcgccggaaaatgaagtcg |
313 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50261 |
atcacactcctacacttgcttgttctgttagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgtcgcctcgccggaaaatgaagtcg |
50360 |
T |
 |
| Q |
314 |
gtgaaaccttcaccgtcgtctcggatttcactttccggtcgccggagcaggaag |
367 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50361 |
gtgaaaccttcgccgtcgtctcggatttcactttccggtcgccggagcaggaag |
50414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University