View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2007_high_3 (Length: 289)
Name: NF2007_high_3
Description: NF2007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2007_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 39403638 - 39403753
Alignment:
| Q |
18 |
cataaactcgagcaaatagttgtgagatgatctagggcggattcaaaggcggcgtgagatgattagtgaaaaacttcaaggagatgaagtagtaggacgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403638 |
cataaactcgagcaaatagttgtgagatgatctagggcggattcaaaggcggcgtgagatgattagtgaaaaacttcaaggagatgaagtagtaggacgg |
39403737 |
T |
|
| Q |
118 |
gaaaaccttgtgttag |
133 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39403738 |
gaaaaccttgtgttag |
39403753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 208 - 270
Target Start/End: Original strand, 39403828 - 39403890
Alignment:
| Q |
208 |
gcaaaactcattacaagtaaatatttttctacaaaaatggtgaattggtaagccacatggcat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403828 |
gcaaaactcattacaagtaaatatttttctacaaaaatggtgaattggtaagccacatggcat |
39403890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University