View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2007_low_7 (Length: 225)
Name: NF2007_low_7
Description: NF2007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2007_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 208
Target Start/End: Complemental strand, 51035848 - 51035655
Alignment:
| Q |
15 |
caaaggaaaacagtaagtgcactgatcatattatatagtcttataaattgttacaattccattattctaattctttctatgatgtgtgtttttatgccat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51035848 |
caaaggaaaacagtaagtgcactgatcatattatatagtcttataaattgttacaattccattattctaattctttctatgatgtgtgtttttatgccat |
51035749 |
T |
 |
| Q |
115 |
gcagtggaggagcctgtgaagttcgaaggaaattattgttggaagcccttgccaatgaacttcctagtggcaccattagatacatgtcaaaggt |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51035748 |
gcagtggaggagcctatgaagttcgaaggaaattattgttggaagcccttgccaatgaacttcctagtggcaccattagatacatgtcaaaggt |
51035655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 140 - 208
Target Start/End: Complemental strand, 51031532 - 51031464
Alignment:
| Q |
140 |
aaggaaattattgttggaagcccttgccaatgaacttcctagtggcaccattagatacatgtcaaaggt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
51031532 |
aaggaaattattgttggaagcccttgccaatgaacttcccaatggcaccattaggtacatgtcaaaggt |
51031464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 51064273 - 51064212
Alignment:
| Q |
147 |
ttattgttggaagcccttgccaatgaacttcctagtggcaccattagatacatgtcaaaggt |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
51064273 |
ttattgttggaagcccttgcaaatgaacttcccaatggcaccattaggtacatgtcaaaggt |
51064212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 51069676 - 51069618
Alignment:
| Q |
147 |
ttattgttggaagcccttgccaatgaacttcctagtggcaccattagatacatgtcaaa |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | | |||||||||| ||||||||||| |
|
|
| T |
51069676 |
ttattgttggaagcccttggcaatgaacttccaaatagcaccattaggtacatgtcaaa |
51069618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 40616515 - 40616576
Alignment:
| Q |
147 |
ttattgttggaagcccttgccaatgaacttcctagtggcaccattagatacatgtcaaaggt |
208 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||| |||||||| ||||| ||| |||||||||| |
|
|
| T |
40616515 |
ttattgttggaagcccttgctagtgagcttccaagtggcactattaggtacttgtcaaaggt |
40616576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 56
Target Start/End: Complemental strand, 51064518 - 51064477
Alignment:
| Q |
15 |
caaaggaaaacagtaagtgcactgatcatattatatagtctt |
56 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
51064518 |
caaaggaaagtagtaagtgcactgaacatattatatagtctt |
51064477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University