View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20080_high_8 (Length: 247)
Name: NF20080_high_8
Description: NF20080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20080_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 233
Target Start/End: Original strand, 30993282 - 30993500
Alignment:
| Q |
15 |
agataatgctttgaattacagactctgtcgatgggcacattcgtacttgggagaaacatgatcaatggatgaggtcatgcattttcaaagtcatatctta |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30993282 |
agataatgctttgaattacagactttgtcgatgggcacattcgtacttaggagaaacatgatcaatggatgaggtcatgcattttcaaagtcatatctca |
30993381 |
T |
 |
| Q |
115 |
tagtgtgttcgaaaatattgtccacgaacttacaatttcatgccattaaccacactcagttatttcatacatgaaattagaagttccctcaaaaccaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30993382 |
tagtgtgttcgaaaatattgtccacggacttacaatttcatgccattaaccacactcagttatttcatacatgaaattagaagttccctcaaaaccaaaa |
30993481 |
T |
 |
| Q |
215 |
acaagaatactatgactca |
233 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
30993482 |
acaagaatactacgactca |
30993500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 31000338 - 31000414
Alignment:
| Q |
15 |
agataatgctttgaattacagactctgtcgatgggcacattcgtacttgggagaaacatgatcaatggatgaggtca |
91 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| |||| || || ||||||||||||| ||||||||||| |||| |
|
|
| T |
31000338 |
agataatgctttgaattgcagactttgtcgatgggtacatccgaacatgggagaaacatgctcaatggatgaagtca |
31000414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University