View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20080_low_7 (Length: 250)
Name: NF20080_low_7
Description: NF20080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20080_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 116 - 238
Target Start/End: Complemental strand, 4144281 - 4144158
Alignment:
| Q |
116 |
cttatttaaccctccttcaaaaaagaaa-taacacttacttaacccctaaaatatttcaaaatttaaattgaaacttgttatttaacagagtataaattt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4144281 |
cttatttaaccctccttcaaaaaagaaaataacacttacttaacccctaaaatatttcaaaatttaaattgaaacttgttatttaacagagtataaattt |
4144182 |
T |
|
| Q |
215 |
gcaattcgcatacaacaactagaa |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4144181 |
gcaattcgcatacaacaactagaa |
4144158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 4144396 - 4144347
Alignment:
| Q |
1 |
ataacttggacaaaaactgacatgaacataaaccaactattagggacaac |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4144396 |
ataacttggacaaaaactgacatgaacataaaccaactattagggacaac |
4144347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University