View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20081_high_15 (Length: 248)
Name: NF20081_high_15
Description: NF20081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20081_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 6 - 223
Target Start/End: Original strand, 43578445 - 43578661
Alignment:
| Q |
6 |
aataattttgtatggtgagactatatcatttcttgtgtttttgatttatctaaccgaaataggttagggttaactgattttcgtttctcccaatattatt |
105 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
43578445 |
aataattttgtatgatgagactatatcatttcttgtgtttctgatttatctaaccgaaataggttagggttacctgattttcgtttctcccgata-tatt |
43578543 |
T |
 |
| Q |
106 |
ttaagagttcaaacttttgtttgctatgaactcttttttccttattgaaattttattccattgannnnnnnaataaggtttttaacgagatagttgttgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
43578544 |
ttaagagttcaaacttttgtttgctatgaactcttttttcctcattgaagttttattccattgacttttttagtaaggtttttaacgagatagttgttgt |
43578643 |
T |
 |
| Q |
206 |
ttctatcctttagtgttt |
223 |
Q |
| |
|
||||| |||||| ||||| |
|
|
| T |
43578644 |
ttctaccctttaatgttt |
43578661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University