View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20081_high_17 (Length: 244)
Name: NF20081_high_17
Description: NF20081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20081_high_17 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
| [»] scaffold0141 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 82 - 200
Target Start/End: Complemental strand, 20690 - 20572
Alignment:
| Q |
82 |
ttgtcaatgatcgaacttaaagatataaattgtgtgtcatttgatgaataactgagaacaagggagagcgatatggaaaggatgaagtaatgaaagacga |
181 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20690 |
ttgtcaatgatcgaacttaaagatatgaactgagtgccatttgatgagtaactgagaacaagggagagggatatggaaaggatgaagtaatgaaagacga |
20591 |
T |
|
| Q |
182 |
agtcattgctagtagtaac |
200 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
20590 |
agtcattgttagtagtaac |
20572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0141 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 60 - 146
Target Start/End: Complemental strand, 2034 - 1948
Alignment:
| Q |
60 |
tggcccaccctttcttcgaaccttgtcaatgatcgaacttaaagatataaattgtgtgtcatttgatgaataactgagaacaaggga |
146 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| || || || |||||||||| ||||||||||||||||| |
|
|
| T |
2034 |
tggcccaccctttctttgaaccttgtcaatgatcgaacttaaagatatgaactgaatgccatttgatgagtaactgagaacaaggga |
1948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University