View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20081_high_9 (Length: 284)
Name: NF20081_high_9
Description: NF20081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20081_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 9 - 269
Target Start/End: Original strand, 9654572 - 9654832
Alignment:
| Q |
9 |
ataatactaacacaatgcaatcaaatccatgcacaactcataatcacccaatacatttcacaaacccatttagcaaacacccttttgagtttctactcaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9654572 |
ataatactaacacaatgcaatcaaatccatgcacaactcataatcacccaatacatttcacaaacccatttagcaaacacccttttgagtttctactcaa |
9654671 |
T |
|
| Q |
109 |
aatcttcaaactttcactatgcccacaaactgttcgacaaaatgcctaacagaaatgttgtcacttggacaaccttaatttcatcacatctcaaatatgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9654672 |
aatcttcaaactttcactatgcccacaaactgttcgacaaaatgcctaacagaaatgttgtcacttggacaaccttaatttcatcacatctcaaatatgg |
9654771 |
T |
|
| Q |
209 |
gtctgtttcaaaagcctttgagatgttcaatcacatgcgtgtgtcggatgagagaccaaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9654772 |
gtctgtttcaaaagcctttgagatgttcaatcacatgcgtgtgtcggatgagagaccaaat |
9654832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University