View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20081_low_15 (Length: 249)
Name: NF20081_low_15
Description: NF20081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20081_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 245
Target Start/End: Complemental strand, 1100799 - 1100568
Alignment:
| Q |
14 |
attctatcatttctcatatccccattccactgcccatcttctacaacccaccatgatcaaattcgttatgtgtgtgttcgacgcttgcatttctctaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1100799 |
attctatcatttctcatatccccattccactgtccatcttctacaacccaccatgatcaaattcgttatgtgtgtgttcgacgcttgcatttctctaatt |
1100700 |
T |
|
| Q |
114 |
caccatgaccaggaattggttttacctttcatctacttacttttggtattgatttttgcatctcgattgttcaaccatgtctgtctattcccctaccata |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1100699 |
caccatgaccaggaattggttttacctttcatctacttacttttggtattgatttttgcatctcgattgttcaaccatgtctgtctattccactaccata |
1100600 |
T |
|
| Q |
214 |
aaattgaaacttttgagaaatatggccatttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1100599 |
aaattgaaacttttgagaaatatggccatttt |
1100568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University