View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20082_high_33 (Length: 229)
Name: NF20082_high_33
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20082_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 21 - 212
Target Start/End: Original strand, 43186316 - 43186507
Alignment:
| Q |
21 |
aactgataattttcttcatcataaacactaaaataatcttaaaggatacaccggacctctgcatggggggcggaaggcagctgctccgctatcacggcca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43186316 |
aactgataattttcttcatcataaacactaaaataatcttaaaggatacaccggacctctgcatggggggcggaaggcagctgctccgctatcacagcca |
43186415 |
T |
 |
| Q |
121 |
ctaccgcggctactatcgtctattggcaacagatactcgatgtagcaaaccaattgtgtagccttctgcttgcatgctacccatccctccta |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43186416 |
ccaccgcggctactatcgtctattggcaacagatactcaatgtagcaaaccaatttggtagcctcctgcttgcatgctacccatccctccta |
43186507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University