View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20082_high_38 (Length: 213)
Name: NF20082_high_38
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20082_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 4 - 196
Target Start/End: Complemental strand, 31959769 - 31959577
Alignment:
| Q |
4 |
ttgccgccgcccctagggttagcgccgccactctccttgtgagggattctgccttctgttggtgagaaatctactcccgtgtacgtttttgccattggct |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959769 |
ttgccgccgctcctagggttagcgccgccactctccttgtgagggattttgccttctgttggtgagaaatctactcccgtgtacgtttttgccattggct |
31959670 |
T |
|
| Q |
104 |
tgtgctaatttcttacgtaatatgcccttttatagagataaaggggctgctggttgtttactttttctgatccaactattcttcgtcacctaa |
196 |
Q |
| |
|
|||||||||||||||||| |||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31959669 |
tgtgctaatttcttacgtgatattccgtgttatagagataaaggggctgctggttgtttactttttctgatccaactattgttcgtcacctaa |
31959577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 54
Target Start/End: Original strand, 4764666 - 4764713
Alignment:
| Q |
6 |
gccgccgcccctagggttagcgccgccactctccttgtgagggattctg |
54 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
4764666 |
gccgccgctcctagggttagcgtcgccactc-ccttgtgagggattctg |
4764713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University