View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20082_high_39 (Length: 211)
Name: NF20082_high_39
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20082_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 23 - 119
Target Start/End: Original strand, 35340094 - 35340190
Alignment:
| Q |
23 |
ttgacgaaaataggagctaatagcttagtctcattgtgttgtaggagcccctcctttctatttcatcggcactatgggctgatattgtggatgtgtc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35340094 |
ttgacgaaaataggagctaatagcttagtctcattgtgttgtaggagcccctcctttctatttcatcggcagtatgggctgatattgtggatgtgtc |
35340190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 68 - 119
Target Start/End: Original strand, 13579359 - 13579410
Alignment:
| Q |
68 |
agcccctcctttctatttcatcggcactatgggctgatattgtggatgtgtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13579359 |
agcccctcctttctatttcatcggcactatgggctgatattgtggatgtgtc |
13579410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University