View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20082_low_17 (Length: 388)
Name: NF20082_low_17
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20082_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 55 - 372
Target Start/End: Original strand, 26483585 - 26483896
Alignment:
| Q |
55 |
tgttacattgtcttaacacttcaggaaatctagtaggaggaatcatttccgacatgacagtgttggaaagacaaagagcaaggaagaagttccaacatga |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26483585 |
tgttacattgtcttaacacttcaggaaatctagtaggaggaatcatttccgacatgacagtgttggaaagacaaagagcaaggaagaagttccaaca--- |
26483681 |
T |
|
| Q |
155 |
acatgaacatgaacaagatcaacaattttttatggttggttgtgattctgctcttggtgaggttgtagctaactctatgaaacccggggacccgggtttc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26483682 |
---tgaacatgaacaagatcaacaattttttatggttggttgtgattctgctcttggtgaggttgtagctaactctatgaaacccggggacctgggtttc |
26483778 |
T |
|
| Q |
255 |
gaaaacgttgaagaaactgtcaagaaaaggaaagctgatcacaaggtggatgtgaagtccaaagacaagaggatcaaagtgagtgttgaagaaggtgaat |
354 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26483779 |
gaaaacgtcgaagaaactgtcaagaaaaggaaagctgatcacaaggtggatatgaagtccaaagacaagaggatcaaagtgagtgttgaagaaggtgaat |
26483878 |
T |
|
| Q |
355 |
ccaaaatcacggagcaaa |
372 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26483879 |
ccaaaatcacggagcaaa |
26483896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University