View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20082_low_33 (Length: 237)
Name: NF20082_low_33
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20082_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 37216223 - 37216003
Alignment:
| Q |
1 |
ctttggggggtagtcattgtttagtttaggatccacacattgtttcactttgtcctcactcaaccttggagttgcctgaaatagttattnnnnnnncaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37216223 |
ctttggggggtagtcattgtttagtttaggatccacacattgtttcactttgtcctcactcaaccttggagttgcctgaaatagttattaaaaaaacaca |
37216124 |
T |
 |
| Q |
101 |
ttggcaaaagagtagactatacaacagaaaataaaccaattaagttaattaacttgagaagaaaaatcaaaatttgaggggataggtacatacccaagtc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37216123 |
ttggcaaaagagtagaatatacaacagaaaataaaccaattaagttaattaacttgagaagaaaaatcaaaatttgaggggataggtacatacccaagtc |
37216024 |
T |
 |
| Q |
201 |
acaagactttgttgcccttta |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37216023 |
acaagactttgttgcccttta |
37216003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 2 - 77
Target Start/End: Complemental strand, 23409755 - 23409680
Alignment:
| Q |
2 |
tttggggggtagtcattgtttagtttaggatccacacattgtttcactttgtcctcactcaaccttggagttgcct |
77 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| | ||||||||||||| |
|
|
| T |
23409755 |
tttgggggatagtcattgtttagtttaggatccacacattgcttcactttgtcttcacttagtcttggagttgcct |
23409680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 221
Target Start/End: Complemental strand, 23409577 - 23409544
Alignment:
| Q |
188 |
acatacccaagtcacaagactttgttgcccttta |
221 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
23409577 |
acatacccaagttacaagactttgttgcccttta |
23409544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University