View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20082_low_34 (Length: 229)

Name: NF20082_low_34
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20082_low_34
NF20082_low_34
[»] chr5 (1 HSPs)
chr5 (21-212)||(43186316-43186507)


Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 21 - 212
Target Start/End: Original strand, 43186316 - 43186507
Alignment:
21 aactgataattttcttcatcataaacactaaaataatcttaaaggatacaccggacctctgcatggggggcggaaggcagctgctccgctatcacggcca 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
43186316 aactgataattttcttcatcataaacactaaaataatcttaaaggatacaccggacctctgcatggggggcggaaggcagctgctccgctatcacagcca 43186415  T
121 ctaccgcggctactatcgtctattggcaacagatactcgatgtagcaaaccaattgtgtagccttctgcttgcatgctacccatccctccta 212  Q
    | |||||||||||||||||||||||||||||||||||| ||||||||||||||||  ||||||| |||||||||||||||||||||||||||    
43186416 ccaccgcggctactatcgtctattggcaacagatactcaatgtagcaaaccaatttggtagcctcctgcttgcatgctacccatccctccta 43186507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University